Retrograde BMP signaling and canonical pMad/Medea-mediated transcription regulate diverse target genes across subsets of Drosophila efferent neurons, to differentiate neuropeptidergic neurons and promote motor neuron terminal maturation. How a common BMP signal regulates diverse target genes across many neuronal subsets remains largely unresolved, although available evidence implicates subset-specific transcription factor codes rather than differences in BMP signaling. Here we examine the cis-regulatory mechanisms restricting BMP-induced FMRFa neuropeptide expression to Tv4-neurons. We find that pMad/Medea bind at an atypical, low affinity motif in the FMRFa enhancer. Converting this motif to high affinity caused ectopic enhancer activity and eliminated Tv4-neuron expression. In silico searches identified additional motif instances functional in other efferent neurons, implicating broader functions for this motif in BMP-dependent enhancer activity. Thus, differential interpretation of a common BMP signal, conferred by low affinity pMad/Medea binding motifs, can contribute to the specification of BMP target genes in efferent neuron subsets.
We recently demonstrated that the BMP-AE motif serves as a widely-deployed BMP-dependent activator of gene expression in larval Drosophila efferent neurons (Vuilleumier et al., 2019). In that study, BMP-AE motifs were shown to confer BMP-dependence on enhancers that were active in diverse patterns across the many subtypes of efferent neurons. This diversity did not appear to be encoded by sequence differences within BMP-AEs. For example, enhancers that included similar 15 bp BMP-AE sequences differed greatly in expression pattern (such as Van 50 and Van 27 reporters), and swapping BMP-AE sequences between enhancers failed to change expression pattern (Vuilleumier et al., 2019). This notion is supported by recent work in Drosophila follicular epithelium and wing imaginal disc showing that the cis-regulatory environment around BMP-AE motifs, bound by other transcription factors, determines the enhancer’s spatiotemporal activity, while the BMP-AE itself acts as a ‘monotonic’, or generic, interpreter of BMP activity (Chayengia et al., 2019).
The integration of BMP-activated pMad/Medea with subtype-specific transcription factors in Drosophila neurons has only been examined in detail in Tv4-neurons (Chayengia et al., 2019). Here a Tv4-neuron-specific transcription factor code and pMad/Medea were found to bind within a Tv4neuron-specific enhancer of the FMRFa gene (Allan et al., 2003; Allan et al., 2005; Miguel-Aliaga et al., 2004; Berndt et al., 2015; Benveniste et al., 1998), at a minimal 25 bp Homeodomain-Responsive Element, and a minimal 39 bp BMP-Responsive Element, respectively (Berndt et al., 2015). Misexpression of combinations of these transcription factors in other efferent neurons (with activated retrograde BMP signaling) led to widespread ectopic FMRFa gene activation (Allan et al., 2003; Eade and Allan, 2009; Allan et al., 2005; Miguel-Aliaga et al., 2004; Berndt et al., 2015; Benveniste et al., 1998; Baumgardt et al., 2009). By contrast, neither ectopic activation nor reduction in BMP signaling was found to alter Tv4-specific FMRFa expression. A parsimonious model emerging from these studies would suggest that activator BMP-RE motifs add a generic BMP-responsive input for an enhancer whose spatiotemporal activity is otherwise determined by subtype-specific transcription factors.
Here we provide evidence for a second model, in which low affinity BMP-RE motifs instructively contribute to subtype-specific gene expression within subsets of BMP-activated efferent neurons. By functional and biochemical dissection of the 39 bp BMP-responsive cis-element of the FMRFa enhancer, we identified a non-canonical minimal pMad/Medea binding motif [GGCGCC(N5)GTAT], which has low affinity (LA) compared to BMP-AE and BMP-SE motifs, that we herein term BMP-LA. Our genetic analysis showed that pMad and Medea act through this motif to directly activate FMRFa expression, without any contribution from brinker or schnurri. Notably, by converting this motif into a high affinity BMP-AE motif, we observed ectopic expression of BMP-dependent reporter activity into other neuronal populations, and a loss of expression in the Tv4-neuron itself. Finally, in silico searches and subsequent enhancer activity analysis revealed other functional instances of this motif in the genome. Overall, our results identify a novel low?affinity?BMP-RE motif type (BMP-LA), and lead to our proposal that the relative strength of BMP-responsive motifs is utilized to confer subtype-specific expression of BMP target genes in neurons.
Results
A 445 bp enhancer region mediates Tv4-neuron-specific expression of the FMRFa gene (Benveniste et al., 1998; Benveniste and Taghert, 1999). We recently sub-mapped this enhancer and defined two short cis-elements that are together necessary for enhancer activity, but are not individually sufficient (Berndt et al., 2015). Toward defining the information encoded by each cis-element, we found that concatemers for both cis-elements independently generate highly specific Tv4-neuron activity in late embryos. Thus, both contain sufficient information for Tv4-specific activity. This allowed us to explore their transcription factor inputs, leading to their definition as a homeodomain-responsive cis-element (HD-RE) and a BMP-responsive cis-element (BMP-RCE). The HD-RE recruits and is activated by the LIM-homeodomain transcription factor, Apterous, but does not require BMP-signaling for activation. The BMP-RCE requires BMP-signaling for its activity and recruits pMad sequence-specifically at a GGCGCC site (Berndt et al., 2015; Figure 1A).
A novel BMP-Response element (BMP-RE) in the Tv4-neuron-specific enhancer of the FMRFa gene.
The 445 bp Tv4-enhancer depicted in (A) contains two cis-elements critical for FMRFa activation, the homeodomain response element (HD-RE that recruits Apterous), and the BMP response element (BMP-RCE) that binds pMad and mediates the BMP-dependence of the Tv4-enhancer. (B) Output from the UCSC Browser shows sequence conservation through the BMP-RE across 21 Drosophila species. Capitalized letters are conserved across all species. Highlighted sequences include the putative Mad/Brinker binding site (magenta), two 5’ optimal GNCV Medea binding sequences with non-canonical spacing (green), and three 3’ sequences that deviate from a non-stringent GNCN sequence?in one critical nucleotide (yellow, orange). The yellow GTAT motif is ideally spaced but has a C?>?A switch. The orange GTTACA contains two motifs (GTTA with a C?>?T switch, and TACA with a G?>?T switch). (C) Comparison of a putative FMRFa BMP-RE with the well-defined BMP-SE and BMP-AE motifs. (D-F) FMRFa immunoreactivity in Tv4-neurons is lost in Medea nulls (E,F) compared to controls (D). Insets show mean number of FMRFa-positive Tv4-neurons per VNC?±?SD. (D’-F’’) Fluorophore splits of single Tv?-clusters in A-C, showing Tv-neurons (circled) labeled by anti-Eya (green) and anti-FMRFa (magenta) expression in each genotype.
The 15 bp FMRFa BMP-responsive cis-element contains a novel pMad/Medea-binding motif
Here we explored how the 39 bp BMP-RCE encodes activity that is BMP-dependent and Tv4-neuron-specific. We previously defined the necessity of a palindromic GGCGGC pMad-binding sequence, but not its associated Medea-binding sequence (Berndt et al., 2015). Here we find two GNCV-types sequences 5’ of the GGCGCC sequence; spaced 3 and 11 nucleotides away (green highlight in Figure 1B). Although not of canonical 5nt length, BMP-AE motifs with altered linker lengths have been shown to retain activity (Weiss et al., 2010; Chayengia et al., 2019; Esteves et al., 2014). We substitution mutagenized the 15 bp region containing these sequences, within the context of a full-length 445 bp Tv4-enhancer (Figure 1—figure supplement 1A). This mutant reported wildtype levels of enhancer activity in Tv4-neurons; therefore, we discounted all sequences 5’ of the pMad-binding site as essential (Figure 1—figure supplement 1B,C).
Within sequences 3’ of pMad-binding site in the remainder of the minimal 39 bp region, there are no consensus GNCV or GTCT motifs. However, three sequences deviate from the consensus by only a single nucleotide, including a perfectly conserved GTAT sequence spaced five nucleotides from the pMad site (yellow highlight in Figure 1B), and a conserved GTTACA spaced 12nt from the pMad motif, with partially overlapping GTTA and TACA sequences (orange highlight in Figure 1B).
pMad and Medea are direct activators of FMRFa
The lack of a canonical Medea site, necessary for BMP-RE motif activity, led us to test if Medea is even required for FMRFa expression. In two different null Medea backgrounds, immunoreactivity to the FMRFa prepropeptide was entirely lost (Figure 1D–F). Anti-Eya staining revealed that all four Tv neurons were generated. We also examined EYFP reporter expression driven from the full length 445 bp TvWT-EYFP enhancer, and from the concatemerized BMP-RCE and HD-RE reporters (Berndt et al., 2015). As expected, TvWT-EYFP and BMP-RCE-EYFP expression were eliminated, while the BMP-insensitive HD-RE-EYFP exhibited expression comparable to controls (Figure 1—figure supplement 1D–I). Thus, Medea is selectively required for the?BMP input that activates FMRFa expression.
Neither brinker nor schnurri are required for BMP-dependent FMRFa.
(A,B) Expression of the?BMP-dependent FMRFa prepropeptide and the Tv4WT-EYFP reporter were not affected in brk mutants. (C,D) Loss of FMRFa prepropeptide and Tv4WT-EYFP in wit nulls was not rescued by the loss of brk in the double mutant of brk and wit. Thus, FMRFa is not lost in wit mutants due to the de-repression of brk. (E) Quantification of data in A-D (n?=?7–12 animals per group, *p<0.01 compared to controls using One-way ANOVA with Tukey HSD post-hoc). (F,G) No change in the number of FMRFa-positive Tv4-neurons was observed between control and shn nulls in late stage 17 embryos. Mean?±?SD number of FMRFa-positive Tv4-neurons per VNC shown in inset, n?=?5 per genotype. (H) In a Brinker de-repression model, brinker would?act as an FMRFa repressor by binding to the BMP-LA element (at the GGCGCC motif). When the BMP signaling pathway is active, the activated pMad/Medea complex would?translocate to the nucleus and bind to the brk BMP-SE element, recruiting Schnurri, and silencing brk expression. This would?allows expression of FMRFa, activated?by other transcription factors and/or direct binding of a pMad/Medea complex. (I) In a direct pMad/Medea complex activation model, FMRFa is only expressed when an activated pMad/Medea complex binds to the BMP-LA sequence. Our work indicates that this latter?model is likely correct, as neither brk nor shn manipulation?modulates BMP-dependent FMRFa expression. Genotypes: Control?(TvWT-nEYFP). brk (brkXA/Y;;TvWT-nEYFP/TvWT-nEYFP). wit (TvWT-nEYFP,witA12/TvWT-nEYFP,witB11). brk;;wit (brkXA/Y;; TvWT-nEYFP,witA12/TvWT-nEYFP,witB11). shn control in F (w;shn?1/+).?shn null in G (shn1/shn1).
The BMP-responsive GGCGCC sequence in the FMRFa BMP-RCE matches this Brk consensus motif (Zhang et al., 2001). If a Brk de-repression model were correct for FMRFa expression (Figure 2H), BMP-induced pMad, Medea, and Schnurri (Shn) would be required to silence brk, resulting in FMRFa de-repression (Marty et al., 2000; Müller et al., 2003). Thus, we would expect that Brk expression would be increased in wit nulls, resulting in FMRFa repression. To test this model genetically, we first examined brkXA/Y hemizygotes, but observed no change in either anti-FMRFa immunoreactivity or Tv4WT-EYFP reporter expression (Figure 2B,E). Second, we tested brk;;wit double mutants to test if the absence of FMRFa in wit mutants is due to upregulation of the brk repressor. Contrary to this hypothesis, FMRFa expression was absent in brk/Y;;witA12/witB11 double mutants (Figure 2D,E), phenocopying wit mutants (Figure 2C,E).
However, this analysis did not rule out the possibility that FMRFa activation requires de-repression by brk as well as direct activation by pMad/Medea, as occurs at BMP-AE motifs regulating dad (Weiss et al., 2010). In such a model, the absence of FMRFa in brk; ;wit nulls may be due to a lack of activation by pMad/Medea. Therefore, we tested FMRFa expression in shn nulls. In this genotype, Brinker and pMad/Medea would all be expressed. In shn (Allan and Thor, 2015) null mutants, we found that FMRFa immunoreactivity was wildtype in late stage 17 embryos, the latest age testable in these mutants due to shn (Allan and Thor, 2015) late embryonic lethality (Figure 2G). Thus, brk de-repression cannot function as the primary mechanism for BMP-dependent FMRFa expression. We conclude that FMRFa is directly activated by pMad/Medea (Figure 2I), with no apparent involvement for shn and brk-mediated de-repression.
The 15 bp FMRFa BMP-RE has reduced pMad/Medea binding relative to canonical BMP-REs
These data led us to test if the pMad/Medea complex is recruited by a non-canonical motif within the FMRFa BMP-RCE. We used an Electrophoretic Mobility Shift Assay (EMSA) to examine nucleotides essential for pMad/Medea binding. We activated BMP signaling in S2 cells, by transfecting S2 cells with FLAG::Mad, Myc::Medea, and activated BMP type I receptor Thickveins (TkvQD) (Gao et al., 2005). From these cells, we obtained total cell lysates to perform EMSA tests on IRDye700-tagged DNA oligonucleotides containing a 27 bp BMP-RE sequence. In Figure 3, we show that co-transfection of all three plasmids was required for a band shift of the FMRFa BMP-RCE probe by BMP-activated S2 cell lysates. Addition of either an anti-Myc or anti-FLAG IgG to the lysate super-shifted the band, whereas a control IgG had no effect. Thus, a BMP-activated pMad/Medea complex isolated from S2 cells bind and band shift the FMRFa BMP-RCE.
An activated pMad/Medea complex binds to the FMRFa BMP-RE.
EMSA using IRDye700-tagged DNA oligonucleotides of the FMRFa BMP-RE incubated with S2 cell extracts transfected with FLAG::Mad and/or Myc::Medea, and/or activated BMP-receptor TkvQD. Lanes 2–7 showed no specific band shift that differed from empty vector transfected cells (lane 1). Co-transfection of FLAG::Mad, Myc::Medea and TkvQD together generated a strong band shift (lane 8). Addition of antibodies to Myc (lane 10) or FLAG (lane 11) caused a super-shifted band that was not seen upon addition an IgG antibody control (lane 9). Thus, Mad, Medea, and activated Tkv receptor were capable of generating a band-shift of the FMRFa BMP-RE.
Next,?we tested which sequences within the BMP-RCE are required for pMad/Medea recruitment. We generated an IRDye-700 tagged wildtype FMRFa BMP-RCE probe comprising a reduced 27 bp FMRFa BMP-RCE (AGAGGCGCCACAATGTATCCCGTTACA), necessary for appropriate in vivo expression (Figure 1—figure supplement 1A). We first tested candidate pMad and Medea binding sites by generating untagged probes with mutant sequence to test their ability to outcompete the wildtype tagged BMP-RE probe when pre-incubated at 10× or 100× excess. We confirmed that mutation of the pMad-binding sequence GGCGCC eliminated binding of the activated pMad/Medea complex (Figure 4A), as previously demonstrated (Berndt et al., 2015). Next, we tested candidate Medea-binding sequences by mutating the GTAT sequence (to TTAT) and the sequence CCCG (to AATT). We found that only mutation of the GTAT sequence reduced binding of the activated pMad/Medea complex (Figure 4B). This indicated that a 15 bp GGCGCC(N5)GTAT motif likely represents the pMad/Medea-recruitment motif for the FMRFa BMP-RCE. We further corroborated these data by comparing the ability of the pMad/Medea complex to bind IRDye-700-tagged BMP-RE oligonucleotides that were either wildtype or contained GTAT mutations predicted to abrogate Medea binding (ACTA or TTAT). Our results demonstrated that pMad/Medea had reduced binding to the mutant sequences (Figure 4—figure supplement 1).
The FMRFa BMP-LA is required for pMad/Medea recruitment but at a lower affinity compared to BMP-AE and BMP-SE motifs.
We performed EMSA gels in which we ran IRDye700-tagged FMRFa BMP-RE DNA oligonucleotides (of sequence AGAGGCGCCACAATGTATCCCGTTACA) pre-incubated with lysates from S2 cells transfected with either empty vectors (EV; lane 1) or FLAG::Mad, Myc::Medea and activated BMP-receptor, TkvQD (MMT lysate; lanes 2–8 or 2–10) (A-B). The MMT lysate generated a band shift indicative of pMad/Medea binding to the tagged probe (lane 2 in A,B). In lanes 3–8 (A) or 3–10 (B), we ran MMT lysates pre-incubated with tagged probe and a stoichiometric excess of untagged (cold) DNA oligonucleotides with either wildtype or mutated sequence (shown below each gel). Loss of a band shift indicates that the untagged probe is capable of binding activated pMad/Medea. (A) We pre-incubated with untagged (cold) competitors of wildtype (WT) sequence or GGCGCC?>TAGTAG mutated sequence (ΔMad) in 1×, 10×, 100× excess. At 100× excess, competition by the WT cold probe reduced the band shift (lane 5). In contrast, the mutated cold probe failed to reduce the band shift at 100× excess (lane 8). (B) We pre-incubated with 10x and 100x excess of cold probes of wildtype (WT) or mutated sequences, including of G and C nucleotides within candidate Medea-binding sequences GTAT (>TTAT, termed ΔGTAT), CCCG (>AATT, termed ΔCCCG), and a mutant to both of these sequences (Δboth). At 100× excess, the wildtype (lane 4) and ΔCCCG (lane 10) greatly reduced the band shift to the same extent; thus, the CCCG sequence does not contribute to pMad/Medea binding. By contrast, the ΔGTAT (lane 6) and Δboth (lane 8) cold probes only partially reduced the band shift, indicating that their ability to bind pMad/Medea was compromised. These data suggest that the minimal BMP-RE comprises a GGCGCC(N5)GTAT sequence. (C-D) The MMT lysate generated a band shift indicative of pMad/Medea binding to the tagged probe (lane 2). We added untagged (cold) BMP-RE DNA oligonucleotides at 100× stoichiometric excess with mutations in the sequences shown in red. (C) Nucleotide mutations are shown as red within the pMad-binding site. (D) Nucleotide mutations are shown as red within the linker region. (E) Nucleotide mutations are shown as red within the Medea-binding site. Examining the ability of each cold competitor to compete with tagged FMRFa BMP-RE, we reveal a necessary BMP-RE sequence of GGCGGGacaatGTaT, where capitalized nucleotides are found most necessary for pMad/Medea recruitment. (F,G) In these EMSA, we additionally transfected S2 cell extracts with a 1×, 5×, and 10× stoichiometric excess of untagged competitors (sequences shown in H). (F) Competition for the tagged BMP-LA by the untagged wildtype (BMP-LA) or the AE-like mutant. A 10× excess (lane 5) of untagged wildtype BMP-LA reduced but did not eliminate the band shift (lane 5). By contrast, the BMP-AE-like mutant totally out-competed the tagged BMP-LA at a 5× excess (lane 7 compared to lane 4) and significantly out-competed the tagged BMP-LA even at equimolar ratio (lane 6 compared to lane 3). (G) Competition for the tagged BMP-LA by the untagged wildtype or the SE-like mutant. The SE-like mutant totally out-competed the tagged BMP-LA at a 5× excess (lane 15 compared to lane 12) and significantly out-competed the tagged BMP-LA even at equimolar ratio (lane 14 compared to lane 11).
We wished to define the sequence requirements for this novel 15 bp BMP-Response Element (BMP-RE). Therefore, we examined band shifts of BMP-activated S2 cell lysates pre-incubated with tagged wildtype BMP-RE DNA oligonucleotides and a 100× stoichiometric excess of cold mutants in which a single nucleotide through the 15 bp motif was substitution mutagenized (Figure 4C–E). Mutagenesis of the entire GGCGCC sequence, or any single nucleotide therein, severely reduced binding of pMad/Medea, as shown by an inability to reduce the band shift of the tagged BMP-RE probe (Figure 4C). In addition, mutation of the entire GTAT sequence, or of any nucleotide except the A, greatly reduced the?binding of pMad/Medea, as shown by retention of a strong band shift of the tagged BMP-RE probe (Figure 4E). By contrast, mutation of any nucleotide within the linker sequence ACAAT only minimally reduced pMad/Medea binding and the band shift was only minimally retained (Figure 4D). We conclude that a minimal 15 bp element of GGCGCCacaatGTaT is essential for pMad/Medea recruitment in vitro (with capitalized letters being essential).
It is intriguing that the position 14 A nucleotide in the putative GTAT Medea binding motif is the only nucleotide not required for pMad/Medea recruitment to this motif in vitro, as a C in this position was shown to be important for pMad/Medea recruitment to BMP-AE and BMP-SE motifs (Pyrowolakis et al., 2004; Weiss et al., 2010). Due to this loss of a key pMad/Medea recruitment nucleotide, we postulate that this position 14 C?>?A switch reduces affinity by introducing a nucleotide that fails to contribute to binding, resulting in the observed reduction of pMad/Medea recruitment.
Hereafter, we term the FMRFa BMP-RE motif as a BMP-Low Affinity Activation motif (BMP-LA). We wished to determine if the C?>?A switch that distinguishes the BMP-LA from the BMP-AE/SE motifs has an impact on BMP-activated pMad/Medea recruitment. To examine this, we tested whether modifying the BMP-LA Medea site to a BMP-AE-like or BMP-SE-like sequence indeed increases its ability to bind pMad/Medea. We generated a series of tagged and untagged DNA oligonucleotides comprising 27 bp of the BMP-LA sequence that was either wildtype at the Medea site, GTAT, or mutated at this site to GACG (BMP-AE-like) or GTCT (BMP-SE-like). By competition EMSA assays, we tested the relative ability of these untagged DNA oligonucleotides to compete for pMad/Medea binding when at 1×, 5×, and 10× stoichiometric ratios relative to the tagged wildtype probe (Figure 4F–G). We found that a wildtype untagged BMP-LA sequence reduced but did not eliminate the band shift generated by its tagged counterpart by 10×. In contrast, both the AE-like and the SE-like sequence mutants proved to be much stronger competitors, totally outcompeting the BMP-LA tagged probe by 5×. Moreover, at equimolar ratios, the untagged wildtype BMP-LA competitor did not substantially alter the tagged probe band shift; however, both AE-like and SE-like mutants reduced the band shift. These data indicate that the GTAT sequence displays low affinity pMad/Medea binding activity relative to the characterized BMP-AE and BMP-SE motifs.
Conversion of the low affinity FMRFa BMP-RE to a high affinity BMP-AE sequence results in ectopic neuronal BMP-dependent activity in vivo
Collectively, our genetic and biochemical data indicated that the BMP-LA motif exhibits low affinity pMad/Medea recruitment. This raised the question as to why the BMP-LA motif is attenuated in this manner, yet conserved across all Drosophila species. To address this, we tested for functional relevance for this motif’s low affinity.
First, we mutated the 445 bp Tv4-enhancer (within the Tv4-nEGFP nuclear-localized?reporter) at the GTAT sequence into ACTA (Tv4mGTAT>ACTA-nEGFP) (sequence shown in Supplementary file 1a), in order to eliminate Medea recruitment. We found that the Tv4mGTAT>ACTA-nEGFP reporter exhibited a total loss of expression in Tv4-neurons, and no ectopic expression was detected in other neurons (Figure 5A,B). We conclude that the GTAT sequence is essential. Second, we tested the effect of converting the GTAT motif of BMP-LA to an optimal BMP-AE-like sequence (GTAT?>?GACG), within the Tv4-nEGFP reporter (Tv4mGTAT>GACG-nEGFP) (sequence shown in Supplementary file 1a). This conversion eliminated Tv4-enhancer activity in Tv4-neurons (Figure 5A,C) but led to strong ectopic reporter activity in other neurons of the VNC (Figure 5D). We noted that all EGFP positive cells were also anti-pMad immunoreactive (Figure 5D’–D”’), suggesting that we had indeed created a high affinity BMP-RE that recruits pMad/Medea to generate BMP-responsive Tv4-enhancer activity in an expanded population of neurons. To confirm this, we tested the wit-dependence of this ectopic reporter activity, by examining the?expression of the mutant BMP-AE-like Tv4-enhancer reporter (Tv4mGTAT>GACG-nEGFP) in a wit mutant background (Figure 5D,E). As expected, this eliminated all reporter activity, demonstrating that the low-to-high affinity conversion created a functional BMP-AE that generated BMP-dependent reporter activity in other BMP-activated neurons of the VNC.
The FMRFa BMP-LA motif has a necessary but low affinity Medea binding site that specifies selective neuronal subtype activity.
(A–C) Conversion of the Medea-binding GTAT site in the wildtype 445 bp Tv4-neuron-specific FMRFa enhancer to a mutant version, ACTA (that reduces pMad/Medea recruitment; termed Tv4 mGTAT>ACTA–nEGFP), resulted in a complete loss of reporter gene expression in Tv4-neurons (B). Conversion of the Medea-binding GTAT site in the wildtype 445 bp Tv4-neuron-specific FMRFa enhancer to an optimal BMP-AE-like sequence (GACG; termed Tv4 mGTAT>GACG–nEGFP) also resulted in a total loss of reporter expression in Tv4-neurons (C). Numbers in insets indicate the mean?±?SD number of EGFP-positive Tv4-neurons per VNC, out of the possible six Tv neurons. (D,E) The Tv4mGTAT>GACG–nEGFP reporter generated strong ectopic reporter activity in VNC midline cells (D) that is lost in the absence of neuronal BMP signaling (E; in wit mutants, witA12/witB11). Full z-projections though the whole VNC are shown. Numbers in insets indicate the mean?±?SD number of EGFP-positive neurons per VNC. (D’–D’’’) Images of the midline ectopic EGFP expression generated from Tv4mGTAT>GACG–nEGFP. EGFP expression (green) was exclusively expressed in pMad-immunoreactive cells (magenta); all cells are yellow circled.
These data show that the low affinity of BMP-LA is essential for the spatially restricted activity of this cis-element to Tv4-neurons.
Identification of additional functional BMP-responsive BMP-LA motifs through the genome
Following the identification of the novel BMP-LA motif regulating FMRFa expression in Tv4-neurons, we examined if this cis-regulatory motif was unique to FMRFa regulation, or functions to confer BMP-dependence to other cis-regulatory regions. To this end, we identified?178 BMP-LA motifs in the D. melanogaster genome using the motif discovery tool HOMER (v4.10) (Heinz et al., 2010). These were filtered for sequence conservation across 24 sequenced Drosophila species using PhastCons scores (Siepel et al., 2005), reducing the list to 128 BMP-LA with an average PhastCons score over 0.55. Of these 128 BMP-LA, 103 were highly conserved with a score of?over 0.9 (Supplementary file 1b).
We selected 24 of the BMP-LA motifs for functional testing in vivo. Of the 24 prioritized motifs, 20 were highly conserved (average PhastCons score?>0.9) and chosen in order to optimize the chance of characterizing functional BMP-RE's. Additionally, four motifs with lower scores 0.75–0.55 were tested for functionality (Table 1, Supplementary file 1c). We examined reporter activity driven from these genomic fragments in late third instar larvae (L3). Of the 24 reporters, five showed no expression in the ventral nerve cord (VNC) (Figure 6—figure supplement 1A), while the remaining 19 reporters exhibited low to high reporter activity in the VNC (Table 1). Of these active reporters, 10 exhibited expression in subsets of pMad-positive cells in the VNC, and also numerous pMad-negative glia and neurons (Table 1). The remaining nine active reporters were restricted to pMad-negative glia and neurons (Figure 6—figure supplement 1B). We tested the BMP-responsiveness of the 10 reporters expressed in pMad-positive cells, by placing them in a wit mutant background. Out of those 10 reporters, seven showed reduced reporter expression (Figure 6B), including two (CM5 and CM7) with motifs of lower PhastCons score. Three reporters showed no significant change (Figure 6A, Figure 6—figure supplement 1B). Quantification of reporter expression in the VNC of controls and their corresponding wit mutants revealed a loss of up to 88% of reporter-expressing cells in certain genotypes (Figure 6—figure supplement 2B).
Table 1
Summary table of expression pattern and wit-responsiveness for BMP-LA containing DNA fragments tested in vivo.
The first column indicates the name for each of the cloned BMP-LA containing DNA fragments; these were sorted based on intensity and pattern of reporter expression. The second column provides information on reporter expression in the VNC, (more plus signs indicate higher intensity), and the final column provides details on expression pattern. The third and fourth columns indicate fragments that exhibited pMad and reporter co-expression, as well as the ones that were shown to be wit-responsive. Bolded letters indicate the enhancer fragments that were further tested for wit-responsiveness. The?expression pattern was assessed in wandering third instar larvae.
Identification of additional wit-responsive genomic fragments containing the BMP-LA motif.
We identified 10 genomic fragment reporters that exhibited expression in subsets of pMad-positive cells in the VNC and tested their wit-responsiveness. (A) EGFP reporter patterns of three genomic fragments that exhibit no wit-responsive loss of reporter expression in wit mutants (witA12/witB11) compared to controls (witA12/+) in late third Instar larval VNCs. (B) Nuclear EGFP expression patterns driven from seven genomic fragments containing conserved BMP-LAs that were down-regulated in wit mutants (witA12/witB11), compared to controls (witA12/+) in late third Instar larval VNCs. The observed down-regulation ranged from a near-total loss of all neuronal expression to loss of expression in a subset of neurons. Full z-projections though the whole VNC are shown. Genotypes: All control lines shown here were heterozygous (w;;CM#/+); wit mutants (w;;CM#,witA12/witB11).
Next,?we tested whether the activity of the identified wit-responsive fragments was dependent on the BMP-LA motif within these genomic fragments. We selected four wit-responsive fragments (CM1, CM2, CM3, and CM7) and one non-wit responsive fragment (CM9; Figure 7A). We introduced nucleotide substitution mutations into the pMad-binding site of the LA (GGCGCC?>?TGATGA). In all four wit-responsive fragments tested, there was a significant loss of reporter expressing cells (Figure 7B). Finally, having established the necessity of Medea for BMP-dependent activity of the FMRFa BMP-RE, we tested the requirement for Medea in reporter expression these same BMP-dependent CM1, CM2, CM3, and CM7 reporters. In Medea mutant third instar (L3) larvae, reporter expression was reduced in the same pattern as observed in a wit mutant background (Figure 7—figure supplement 1).
The GGCGCC pMad-binding site is necessary for reporter expression in vivo.
We introduced specific mutations into the pMad-binding site of the BMP-LA motif (GGCGCC?>TGATGA) of four wit-responsive fragments (CM1, CM2, CM3, and CM7) and one non-wit responsive fragment (CM9) to verify whether reporter activity was dependent on pMad binding. (A) CM9 showed no significant loss of reporter expression in the CM9Δmad mutant compared to the control. (B) All four wit-responsive fragments exhibited a significant loss of reporter expressing cells; however, this loss was less pronounced than the loss in wit mutants, apart from CM3. Full z-projections though the whole VNC are shown. Genotypes: All control and pMad-binding site mutant lines examined here were heterozygous (w;;CM#/+).
We conclude that the BMP-LA is utilized by numerous cis-regulatory regions in order to generate BMP-dependent enhancer activity in neurons.
Discussion
Retrograde BMP signaling, and BMP responsive DNA motifs in target gene enhancers, have been viewed as functionally equivalent across efferent neuron populations. Therefore, the differential expression of BMP target genes across efferent neuron populations has been attributed to the activity of subtype-specific transcription factors (Veverytsa and Allan, 2011; Miguel-Aliaga et al., 2008; Allan et al., 2005). Here we describe our identification of a low affinity BMP-responsive DNA motif that appears to instructively contribute to differential specification of BMP target genes across efferent neuron subtypes.
Our previous work had identified a 39 bp BMP responsive cis-element within the Tv4-enhancer of FMRFa that is absolutely required for Tv4-enhancer activity, and encodes sufficient information for selective activity in Tv4-neurons (Berndt et al., 2015). Here we reveal that pMad and Medea are recruited to this cis-element by an essential low affinity motif (the BMP-LA). Converting this motif to a high affinity BMP-AE motif led to Tv4-enhancer activity in a broader set of efferent neurons, as would be expected from BMP-AE’s generic responsiveness across many efferent neurons and Drosophila tissues (Vuilleumier et al., 2019; Chayengia et al., 2019). These results provide evidence that low affinity BMP responsive motifs instructively restrict BMP target genes within subsets?of?efferent neuron.
Low affinity motifs serve widespread roles in restricting gene expression in space and time (Crocker et al., 2015). They function to reduce enhancer activity in order to prevent ectopic expansion of enhancer activity (Wharton et al., 2004; Farley et al., 2015; Jiang and Levine, 1993). They are also required to generate enhancer activity with the appropriate expression domain; for example, Hedgehog regulation of numerous wing imaginal disc and embryonic enhancers requires Ci transcription factor binding to low affinity motifs; increasing their affinity abolished enhancer activity (Ramos and Barolo, 2013). Also, clustered low affinity motifs have been shown to improve discrimination between transcription factors with similar binding preferences, and to locally concentrate transcription factors to ensure robust target gene expression (Crocker et al., 2015).
How does the BMP-LA confer Tv4-neuron specificity? We propose that the BMP-LA does not singularly specify Tv4 neuron activity, but rather imposes a requirement for pMad/Medea cooperative interactions with subtype-specific transcription factors bound to adjacent motifs for combinatorial activation of FMRFa expression. Four primary lines of evidence inform our conclusion. First, lowering or ectopically hyperactivating BMP signaling in other neurons failed to trigger ectopic Tv4-enhancer or FMRFa expression, without also co-misexpressing Tv4-specific transcription factors (Allan et al., 2003; Allan et al., 2005; Miguel-Aliaga et al., 2004; Eade et al., 2012; Berndt et al., 2015). This rules out a model whereby BMP-LA’s lower affinity is tuned for a specific level of BMP signaling only observed in Tv4-neurons. Second, the minimal BMP-responsive, Tv4-specific cis-element within the Tv4-enhancer cannot dispense with a highly conserved sequence 3’ of the BMP-LA. This sequence likely contains binding sites for other transcription factors that synergize with pMad/Medea to specify FMRFa expression in Tv4-neurons. These transcription factor(s) remain unidentified at this time. Third, BMP-LA motifs in other genomic regions confer BMP-dependent enhancer activity across other efferent neurons, suggesting that the BMP-LA imposes a requirement for pMad/Medea synergistic interactions with other transcription factors that combinatorially specifies neuronal subtype expression. Fourth, converting the BMP-LA to a BMP-AE resulted in a loss of reporter expression within its appropriate domain (Tv4-neurons), but an inappropriate expansion of BMP-responsive activation into other efferent neurons. This strongly suggests that the BMP-LA imposes transcription factor interactions that the BMP-AE is unable to replicate in Tv4-neurons; yet are unnecessary for generic BMP-AE activity in other efferent neurons. These specific interactions may occur between transcriptional regulators that require a specific pMad/Medea conformation that is imposed by the BMP-LA sequence. Precedent for this comes from analysis of Schnurri binding to pMad and Medea bound at the BMP-SE, which requires a pMad/Medea conformation that is imposed by a precise 5nt linker between the Mad and Medea binding motifs and also a terminal T at position 15 of the BMP-SE motif (Gao et al., 2005; Pyrowolakis et al., 2004; Müller et al., 2003). No such sequence constraints appear to be required for pMad/Medea activity at the BMP-AE (Weiss et al., 2010; Chayengia et al., 2019). Alternatively, but not mutually exclusively, these specific interactions may occur between other transcription factors bound to adjacent DNA motifs and a pMad/Medea conformation imposed by the BMP-LA sequence. Precedent for such a model comes from evidence that conversion of a low?affinity Pax6 site in the chicken DC5 enhancer to a high-affinity site disrupted the formation of an activation competent Sox2-Pax6 complex, and decreased enhancer activity (Kamachi et al., 2001; Uchikawa et al., 2003). Similarly, single nucleotide differences in NF-κB binding sequences determine cofactor specificity for NF-κB dimers (Leung et al., 2004; Pan et al., 2010). A similar instructive role for low affinity motifs in generating exquisitely subtype-specific neuronal gene expression has been proposed in Drosophila (Jafari and Alenius, 2015; González et al., 2019). The exclusive expression of odorant receptor genes in specific olfactory sensory neurons is encoded by arrays of low affinity binding sites for multiple transcription factors. The authors propose that these low affinity motifs provide the necessary environment for the weak and somewhat promiscuous binding for numerous transcription factors that ultimately establishes the cooperative interactions that stabilizes target gene activation in a single neuronal subset.
Our results add to growing evidence that BMP-dependent gene regulation can be profoundly altered by subtle nucleotide substitutions within the 4-nucleotide Medea-recruitment site of these response elements; a BMP-dependent activator (GNCV), a BMP-dependent repressor (GNCT), and a low affinity activator that generates restricted activation (GTAT). The sequence similarity yet diverse functional output of these three BMP-REs reveals the diversity of responses that can be generated from subtle sequence deviations from a core BMP-RE motif. This raises a challenge for computational approaches for BMP-RE motif discovery; a specific high affinity motif will not capture all functional motif instances, but a degenerate motif built from multiple BMP-RE motifs would increase background noise to unacceptably high rates. Moreover, our discovery here of a novel motif with predictive value only increases the promise that more BMP-REs with predictive value will be discovered. However, as demonstrated by numerous studies, accounting for low affinity sites has proven to be beneficial in identifying functional enhancers (Zandvakili et al., 2018; Gurdziel et al., 2015). Therefore, it remains important to identify novel BMP-responsive motifs with demonstrated predictive value in BMP-RE discovery. Regardless, considerable degeneracy has been found in the sequences of BMP-REs (Ross and Hill, 2008) and it is important to acknowledge that in silico BMP-RE discovery will always under-represent functional BMP-REs in any system.
We started this study by sub-mapping a minimal BMP-responsive, Tv4-specific cis-element to a short 27 bp region that contains the canonical GGCGCC pMad-binding site, but no canonical Medea-binding site. After dismissing the expected model that this motif would mediate Brk default repression and BMP-dependent de-repression, we defined a minimal 15 bp GGCGCC(N5)GTAT bipartite motif required for pMad/Medea recruitment. The low affinity of this motif arises from the C?>?A nucleotide switch at position 14; removing the C nucleotide required for pMad/Medea recruitment to BMP-AE and BMP-SE (Pyrowolakis et al., 2004; Weiss et al., 2010), for an A nucleotide that plays no role in recruitment (Figure 4E). Interestingly, this loss of recruitment activity at motif position 14 leads to increased nucleotide stringency at positions 2, 5, 12, and 13 for pMad/Medea recruitment (Figure 4E), which are either unnecessary or less necessary for recruitment to BMP-AE and BMP-SE (Gao et al., 2005; Pyrowolakis et al., 2004; Weiss et al., 2010). Thus, transversion of one core nucleotide requires compensatory pMad/Medea recruitment activity from other nucleotides within the overall 15 bp motif. This could be viewed as exerting an evolutionary pressure on these remaining nucleotides to not exhibit degeneracy across Drosophila species, which may provide an explanation for why the BMP-LA is so highly conserved. By contrast, other low affinity cis-elements exhibit considerable degeneracy, with the hypothesis being that a high affinity, optimal motif would be highly constrained in nucleotide composition, but there could be a variety of nucleotide substitutions that would result in lower affinity motif (Crocker et al., 2015; Ramos and Barolo, 2013; Crocker et al., 2016; Farley et al., 2016).
Overall, our results show that differential BMP-dependent gene expression in neuronal subtypes is not only conferred by the integration of pMad/Medea into a combinatorial transcription factor code. In addition, sequence variation of the BMP-RE that is bound by pMad/Medea provides additional critical information required to selectively trans-activate gene expression in specific neuronal subtypes. Further work is required to identify transcription factors that bind the highly conserved sequences that flank the BMP-LA motif in the FMRFa Tv4-enhancer, or interact directly with the BMP-LA motif itself. Once such factors are identified, we will be able to directly assess the contribution of pMad/Medea affinity and specific transcription factors to the BMP-LA in order to form subtype-specific, activation-competent complexes.
TvWT-EYFP, BMP-RE-EYFP, HD-RE-EYFP were generated previously (Berndt et al., 2015). Drosophila transformations were performed by Rainbow Transgenic Flies, Inc (Camarillo, CA). Empty pThunderbird EGFP vector was generated from Tv-nEYFP and from sequence within pHstinger (Berndt et al., 2015; Barolo et al., 2000). Tv4-nEYFP was digested with AscI and SpeI. The multiple cloning site (MCS), HSP70 promoter, EGFP coding sequence, Tra nuclear localization signal, and SV40-polyA sequences from pHstinger (Barolo et al., 2000) were liberated with AscI and SpeI and ligated into the cut Tv-nEYFP backbone. The Tv4-enhancer was PCR-amplified from Oregon-R with XbaI and EcoRI adaptors, restriction digested and ligated into XbaI/EcoRI digested empty Tv4-nEYFP. SOE PCR generated nucleotide substitution and deletion mutants were inserted similarly. Summary of all mutations and concatemerization sequences in Supplementary file 1a. pMad-binding site mutagenesis was performed by Q5 Site-Directed Mutagenesis Kit (New England Biolabs,?Ipswich,?MA), using primers designed to introduce specific base pair substitutions to the Mad binding site (GCCGGC?>?tgatga), according to manufacturer`s protocols. All constructs were verified by sequencing before the generation of transgenic fly lines. Fly transformations were performed by Rainbow Transgenic Flies, Inc (Camarillo, CA). All transgenic reporters were integrated into attP2 (Groth et al., 2004).
Immunochemistry was performed as previously described (Eade and Allan, 2009; Berndt et al., 2015). Primary antibodies: Rabbit α-FMRFa C-terminal peptide (1:1000, a gift from S. Thor) Baumgardt et al., 2007; Mouse α-Eya (1:100; MAb clone 10H6 DSHB; Iowa University,?IA); Rabbit α-pMad (1:100, 41D10, Cell Signaling Technology, Danvers,?MA), Chicken α-GFP antibody (1:1000, ab13970, Abcam, Ontario, Canada). Donkey anti-Rabbit and anti-Mouse conjugated to DyLight 488, Cy3, Cy5 (1:100, Jackson ImmunoResearch, West?Grove,?PA).
Sample size and measurements are given as supplementary files for each accompanying figure. Analysis of the reporter constructs was performed on heterozygous reporter lines. Images were acquired with an Olympus FV1000 or a Zeiss Axio Imager VIS LSM880 confocal microscope with settings that avoided pixel intensity saturation. Representative images of Tv neurons being compared in figures were linear contrast enhanced together in Adobe Photoshop CS5 (Adobe Systems, San?Jose,?CA). All statistical analyses and graphing were performed using Prism 5 or Prism 8.0.1 (GraphPad Software, San?Diego,?CA). Normality of sample distribution was determined with Shapiro-Wilk normality tests. All multiple comparisons were done with One-Way ANOVA and a Tukey post-hoc test, or Student’s two-tailed t-test when only two groups were compared. Mann-Whitney U-test was used when the samples were not normally distributed. Differences between groups were considered statistically significant when p<0.05. Data are presented as either Mean?±?Standard Deviation (SD).
Quantification of native EGFP reporter expression (without anti-GFP immunoreactivity enhancement) in late L3 larval VNCs was performed, in the context of anti-pMad immunoreactivity (to mark nuclei with active BMP-signaling). In all cases, five or more VNC were dissected and imaged for each genotype. All compared tissues were processed with the same reagents, imaged, and analyzed in identical ways. To quantitate reporter activity, we used Bitplane:Imaris v9.2 software (in Spots Mode) to identify reporter-positive nuclei in the VNC (excluding the brain lobes). When comparing control and pMad-binding site mutant genomic fragment reporters, we additionally assessed EGFP positive nuclei that were co-marked by pMad immunoreactivity (by mean intensity thresholding). Imaris settings were established independently for each set of reporters, in order to provide optimal ‘spot’ marking of a?verifiable reporter and pMad co-immunoreactive nuclei, with minimal background fluorescence spot marking. Each image was further subtracted, manually, for spots that erroneously labeled background fluorescence.
FLAG::Mad, Myc::Medea, and/or TkvQD cDNA sequences were derived from previously described vectors (Gao et al., 2005) and subcloned into a pAc5.1/V5-His vector backbone (Thermo?Fisher, Waltham,?MA). Drosophila S2 cells were transfected at a density of 1.5 × 106 S2 cells per mL in a six well dish in 2 mL of media. A total of 2.4 ug of plasmid was used per well with each plasmid constituting 0.8 ug of the total. Total plasmid mass was kept constant by co-transfecting empty pAc5.1 when only one or two protein coding plasmids were used for an experimental condition. Transfections were performed with the XtremeGENE HD transfection kit according to the manufacturer’s recommended protocol (Roche, Ontario, Canada). 48 hr after transfection, cells were harvested and lysed for gel shift assay. Cells were harvested in 15 mL tubes then pelleted by centrifugation (700 g at room temperature for 3 min). The pellets were re-suspended in PBS, transferred to 1.5 mL tubes, and centrifugation repeated as before. Cells were then resuspended in 90 μL ice-cold lysis buffer and the lysis reaction incubated on ice for 15 min. S2 cell lysis buffer contained 100 mM Tris HCl pH 7.6, 0.5% Tween-20, 1 mM DTT, and 1× Roche cOmplete ULTRA EDTA-free Protease inhibitor cocktail. The lysate was cleared by centrifugation at 16.2 × 103 g for 15 min at 4°C. The supernatant was aliquoted into new pre-chilled tubes in 30 uL volumes, snap-frozen in liquid nitrogen, and stored at ?80°C until use. Oligonucleotides were synthesized and labeled with IRDye 700 by Integrated DNA Technologies (IDT, Indiana). DNA and protein binding was performed by incubating 20 μg of lysate protein with 1 μL of 50 nM IRDye 700-labeled probe in 20 μL of reaction buffer containing 25 mM Tris pH7.5, 35 mM KCl, 80 mM NaCl, 3.5 mM DTT, 5 mM MgCl2, 0.25% Tween 20, 1 μg poly dIdC, 10% glycerol, and 1× Roche cOmplete ULTRA EDTA-free Protease inhibitor cocktail for 30 min at room temperature. If super shifts were performed, then 1 μg of mouse anti-MYC (clone 9E10, Sigma), mouse anti-FLAG (clone M2, Sigma), or mouse IgG (Sigma) was added and incubated for an additional 30 min at room temperature. The DNA-protein complexes were resolved on a 4% non-denaturing polyacrylamide gel for 1.5 hr at 70 V in 1×?TGE buffer. After electrophoresis, the gel was imaged immediately by a Licor Odyssey Imager system (Lincoln, NE).
HOMER v4.10 software suite (Heinz et al., 2010) was used to scan the reference dm6 Drosophila genome for the BMP-LA (GGCGCC(N5)GTAT) motif. Base-specific PhastCons scores (Siepel et al., 2005) against 27-insect species were obtained from the UCSC genome browser (https://genome.ucsc.edu/) to annotate each motif instance with evolutionary conservation scores (Supplementary file 1b).
Share your feedback+ Open annotations. The current annotation count on this page is being calculated.
Reviewing Editor; Howard Hughes Medical Institute, Columbia University, United States
K VijayRaghavan
Senior Editor; National Centre for Biological Sciences, Tata Institute of Fundamental Research, India
In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.
[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]
Thank you for submitting your work entitled "A suboptimized cis-regulatory BMP response element confers subtype-specific gene activation in Drosophila neurons" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Michael Eisen (Reviewer #1).
Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife in its present state.
However as you'll see from the reviewers comments there was considerable enthusiasm for your work, but all three were of the opinion that the paper requires several additional experiments before we could consider it further at eLife. We appreciate the experiments suggested by the reviewers will take longer than the allowed time frame for revision, but in the case you would be willing to undertake them we would be happy to consider a new version of the manuscript at a future date.
Reviewer #1:
This is a simple, but well executed paper exploring the specificity of a 39bp BMP responsive element that confers neuronal specificity to the FMRFamide gene. I have no real issues with the experiments, as they convincingly establish that:
a) Medea is required to activate this construct
b) That the 39bp element is not dependent on Brinker or Schnurri
c) That activated Smad binds to the element in vitro in S2 lysates
d) That Smad binding is dependent on the non-canonical sequence GGCGCCNNNNNGTNT which is a poorer recruiter of Smad than the canonical response elements
e) That turning the suboptimal sequence into an optimal one eliminates proper activation and leads to broader ectopic activation.
Although there is now an established body of literature pointing to the importance of weak/suboptimal binding sites in tuning transcriptional responses, especially to graded signals, I think this paper makes a valuable contribution, and I support its publication more of less as is.
My only real tuck is in the interpretation. As the authors note, the loss of expression in the Tv4 neurons when the weak site is transformed into an optimal one, is, while not unprecedented, at least a bit surprising as it either means that stronger Smad binding is repressive for this element or it suggests that there is a dependence on some other factor. The latter hypothesis gains some weight from the observation that the A in the GTAT part of the Smad binding element is not required for Smad binding but is perfectly conserved across the genus. This deserved more attention in the discussion and potentially modifies the way in which these experiments fit in to the broader discussion of the role of suboptimal sites in tuning responses.
Reviewer #2:
This paper utilizes a very well-studied system of a single peptidergic neuron per hemisegment in the Drosophila embryo. Previous work from this and other labs have shown that the appropriate and timely specification of this FMRFa expressing Tv4 neuron requires co-ordinated activity of intrinsic genetic programmes (apterous, eya) with extrinsic, target derived cues (BMP pathway). The authors had previously identified an enhancer region of the FMRFa gene (Tv4 enhancer) that integrates these two genetic programmes and in this study they describe how BMP signaling acts at this enhancer.
BMP dependent gene activation can either be achieved directly through pMAD+Madea/Smad complex acting as transcriptional activators, or through de-repression via Brinker and Schnurri. Using mutants and genetic interactions combined with FMRFa expression and Tv4 reporter activity, (which recapitulates FMRFa expression in the Tv4 neuron), the authors show that the BMP pathway acts via the Madea/Smad mediated transcriptional activation pathway and does not involve Brinker and Schnurri. They then focus on the BMP-RE region of the Tv4 enhancer and identify a putative non-canonical binding site. Using S2 cells transfected with activated BMP receptor and tagged MAD and Madea/Smad along with gel shift assays the authors show that this non-canonical site is indeed essential for Madea/Smad recruitment and describe very thoroughly the sequences that are essential for Madea/Smad recruitment. They also demonstrate that the non-canonical nature of the site renders it sub-optimal in the recruitment of Madea/Smad. Finally, they demonstrate that this sub-optimal recruitment of the complex is essential for the expression of the Tv4 enhancer in the Tv4 neuron.
The experiments described are thorough, the writing is generally quite clear and the findings are interesting in the light of a diversity of outcomes of BMP signaling by changing binding site affinities and related compensatory nucleotide changes.
Specific Comments:
1) Figure 3 and related text: Although the figure and data supporting this section is quite clear, a little more attention to the writing would greatly enhance the interpretation of the data. For example, the authors might consider laying out individual genes and proteins, and their known interactions at both the transcriptional and protein interaction level at the top of the paragraph. A schematic illustrating this, along with possible outcomes of the genetic interactions would also benefit this section.
2) Figure 8: This figure in particular, would be more satisfying if an enlarged merged image was shown with the relevant counterstains and magnified insets of the cells depicting the individual channels were shown alongside.
Reviewer #3:
In their paper "A sub-optimized cis-regulatory BMP response element confers subtype-specific gene activation in Dropshila neurons," Berndt and colleagues provide a focused study on how a common BMP signal generates subtype-specific diversity. They found a minimal Smad-binding motif that matches a consensus motif except for a conserved nucleotide difference that attenuates Smad binding. Interestingly, they demonstrated that conversion to an "optimal" sequence resulted in ectopic reporter activity in other neurons. Together, this provides evidence that "sub-optimization" serves as a mechanism to provide specificity, giving additional evidence to the paradigm that low-affinity sequences are essential for precise gene expression.
While the paper is well done, combining both genetics and biochemistry, it would be great if the results could be expanded to generalize their findings. For example, with such a large consensus motif could the authors find additional motifs across the genome? Are they conserved? Are any of these motifs functional? This could be tested, for example, in existing Rubin Gal-4 lines. So, it could be done in a reasonable timeframe. Additionally, as noted below, the findings could be streamlined for easy reading. As it stands the manuscript is limited in scope and is very specialized.
Finally, "suboptimal." I recommend that the authors re-consider their use of "sub-optimized". As the authors demonstrate, the sequences are highly optimized for Tv4 neuronal expression. Furthermore, these "sub-optimal" sequences are conserved for millions of years, implying that they are optimal for expression. An alternative would be to call them low-affinity sequences, which is internally consistent across their results.
Figures:
1F, add shading as in panel 1B. I would also consider moving D-F to supplementary materials, to tighten up the flow of the paper.
Figure 2. Following from above, if panels D-F are moved to supplemental information, Figures 1 and 2 could be combined to demonstrate a conserved.
Figures 4-6. Much of this could be combined and even added to all of the above. See Crocker et al., 2015 for example; where Figure 2 has conservation, gel-shifts, and embryos with quantification.
References:
Gao et al., 2005 is repeated
For Crocker et al., 2016 cite the main cell paper (Crocker et al., 2015, Cell).
[Editors’ note: further revisions were suggested prior to acceptance, as described below.]
Thank you for submitting your article "A low affinity cis-regulatory BMP response element confers subtype-specific gene activation in Drosophila neurons" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and K VijayRaghavan as the Senior Editor. The reviewers have opted to remain anonymous.
As you will see one of the reviewers is now more satisfied with the paper, but still asks from some slight editorial revisions. The other reviewer, a new reviewer, is taking a moderately supportive view of the manuscript. There is surely some editorial revision that can be easily done and increase satisfaction of the reviewer. The proposed experiment(s) are not essential, but would surely strengthen the paper.
Reviewer #1:
In its revised form, this manuscript addresses the suggestions and concerns that were raised in during its first submission.
Overall, it explores the details of specification of an FMRFa expressing “Tv4” neuron. For the appropriate expression of FMRFa in the Tv4 neuron, intrinsic genetic programmes (apterous, eya) are integrated with extrinsic, target derived cues (BMP pathway) at an enhancer called “Tv4” that the authors had previously identified. Here the authors show that the BMP pathway acts via the Madea/Smad mediated transcriptional activation pathway and does not involve Brinker and Schnurri mediated depression. They identify a non-canonical, low affinity BMP-response element, which is essential for the expression of the Tv4 enhancer in the Tv4 neuron. They next identify other such low affinity binding sites in the Drosphila genome and demonstrate its activity and dependence on Madea function.
This remains a manuscript of niche interest, however, as I had noted in the previous submission, the experiments are thorough and clearly presented. The writing is generally quite clear.
Reviewer #2:
Berndt et al. make an ambitious and thorough analysis of a degenerate BMP responsive element that direct FMRF expression. They demonstrate pMAD/medea to bind the motive bind with low affinity and activate expression from the element. Replacing the motive with a consensus element still direct expression to neurons but of not to the original FMRF neurons. A bioinformatics study identifies 103 conserved similar elements across the Drosophila genome. Production of reporters with selected motives directed expression to both pMAD positive and negative neurons and glia. Even if the take is ambitious and low affinity motives in my view often marginalised, I have some concerns about the general applicability and advances made here.
Major concerns:
The authors state that this study will be important for how bioinformatics view low affinity motives. Even if the analysis is ambitious, the outcome is not encouraging for any predictive use. The cis regulatory regions containing the degenerate motive does not restrict expression to a predictable set of neurons or to neurons in general. The question that remains is if regions with perfect motives would do better or worse in restricting expression to these neurons.
For other signalling systems similar low affinity motives provide instructive values in target gene regulation a phenomenon described as activation insufficiency and important for a signalling system not to dominate the regulation of the particular gene (for review see Barolo and Posakony, 2002). This raises the question if evolution placed this motive strength there to fit a certain signalling level. A question that could simply be addressed by increasing (dominant active, ligand overexpression) or decreasing (heterozygote ligand mutants, ts mutants) signaling activity and observe the reporter. In the current format the signalling twist is there but only for the FMRFamide gene and without any predictive input.
It is argued that “this manuscript defines how common intercellular signals so exquisitely direct subtype-specific gene expression profiles”. There are low affinity instructive models also for neurons. For example, in Drosophila the olfactory system the interaction between several low affinity motifs and chromatin has been modelled and tested to be required to restrict odorant receptor expression to a single neuron class. (Jafari and Alenius, 2015, González and Jafari et al., 2018). However, these factors are not related to known signaling systems one can argue and like that these findings become an advance. Nevertheless, the authors need to make the discussion more comprehensive to make that claim and define the mechanism in more detail.
Thus, the study is well performed and a nice addition to the list of similar studies but with little signalling context, predictive power or computer model testing the study is not a major advance compared to what already is published.
[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]
The only additional experiments that were requested are captured in the comments of reviewer 3:
“While the paper is well done, combining both genetics and biochemistry, it would be great if the results could be expanded to generalize their findings. For example, with such a large consensus motif could the authors find additional motifs across the genome? Are they conserved? Are any of these motifs functional? This could be tested, for example, in existing Rubin Gal-4 lines”
We have now performed the requested experiments and include the results in this re-submitted manuscript. The data confirm the hypothesis that the low-affinity BMP-RE motif we report in this manuscript is a widely deployed, functional BMP-response element.
1) We now provide a list of all motifs matching the low-affinity BMPresponse element (BMP-RE) motif in the D. melanogaster genome and provide their PhastCons scores for motif conservation across all other sequenced Drosophila species (Supplementary File 1B) These analyses were performed using the HOMER suite of tools for Motif Discovery.
2) Based on these data, we selected 24 genomic regions forfunctional characterization of candidate motif activity
(Supplementary file 1C). We cloned ~2kb genomic fragments, inclusive of a single candidate BMP-RE motif, upstream of a nuclearlocalized GFP reporter and integrated these into the attP2 site of Drosophila by phiC31-integrase dependent transgenesis. These were examined for expression in BMP-activated neurons.
3) We observed that 10 of these were expressed in BMP-activated neurons and that the expression of the majority of those (7/10) was significantly reduced in wit nulls, wherein neuronal BMP signalling is abrogated.
4) Based on these results, we performed a second round of transgenesis to confirm that the BMP-RE motif itself is essential for expression, by re-testing reporter expression after mutation of the BMP-RE so as to prevent pMad/Medea binding. The significant reduction in expression for these (that was mostly comparable to the loss of expression of wildtype genomic fragments in wit nulls), confirms that the BMP-RE itself is functional.
Reviewer #1:
[…]
My only real tuck is in the interpretation. As the authors note, the loss of expression in the Tv4 neurons when the weak site is transformed into an optimal one, is, while not unprecedented, at least a bit surprising as it either means that stronger Smad binding is repressive for this element or it suggests that there is a dependence on some other factor. The latter hypothesis gains some weight from the observation that the A in the GTAT part of the Smad binding element is not required for Smad binding but is perfectly conserved across the genus. This deserved more attention in the discussion and potentially modifies the way in which these experiments fit in to the broader discussion of the role of suboptimal sites in tuning responses.
We thank the reviewer for emphasizing the need to enhance this discussion. We have now expanded this discussion.
Reviewer #2:
[…]
Specific Comments:
1) Figure 3 and related text: Although the figure and data supporting this section is quite clear, a little more attention to the writing would greatly enhance the interpretation of the data. For example, the authors might consider laying out individual genes and proteins, and their known interactions at both the transcriptional and protein interaction level at the top of the paragraph. A schematic illustrating this, along with possible outcomes of the genetic interactions would also benefit this section.
This has now been performed (schematic in Figure 2H-I)
2) Figure 8: This figure in particular, would be more satisfying if an enlarged merged image was shown with the relevant counterstains and magnified insets of the cells depicting the individual channels were shown alongside.
This has now been performed (Figure 5D-E)
Reviewer #3:
[…]
Finally, "suboptimal." I recommend that the authors re-consider their use of "sub-optimized". As the authors demonstrate, the sequences are highly optimized for Tv4 neuronal expression. Furthermore, these "sub-optimal" sequences are conserved for millions of years, implying that they are optimal for expression. An alternative would be to call them low-affinity sequences, which is internally consistent across their results.
We thank the reviewer for this suggestion. This phrase is indeed more appropriate.
Figures:
1F, add shading as in panel 1B. I would also consider moving D-F to supplementary materials, to tighten up the flow of the paper.
Figure 2. Following from above, if panels D-F are moved to supplemental information, Figures 1 and 2 could be combined to demonstrate a conserved.
Figures 4-6. Much of this could be combined and even added to all of the above. See Crocker et al., 2015 for example; where Figure 2 has conservation, gel-shifts, and embryos with quantification.
References:
Gao et al., 2005 is repeated
For Crocker et al., 2016 cite the main cell paper (Crocker et al., 2015, Cell).
These have all been corrected.
[Editors’ note: what follows is the authors’ response to the second round of review.]
Reviewer #2:
Major concerns:
The authors state that this study will be important for how bioinformatics view low affinity motives. Even if the analysis is ambitious, the outcome is not encouraging for any predictive use. The cis regulatory regions containing the degenerate motive does not restrict expression to a predictable set of neurons or to neurons in general.
These comments raise important issues that we had not addressed adequately in our previous manuscript. We have softened any statements about what our work says regarding computational approaches to low affinity motif discovery, focusing solely on the fact that the BMP-LA motif can be used in such an approach.
We would argue that our studies do support the predictive value of the BMP-LA motif in the in silico discovery of BMP-responsive cis-elements, as supported by our identification of novel BMP-responsive genomic regions. However, the reviewer’s comments alerted us to an unintended interpretation of our conclusions, implying that the BMP-LA motif inherently confers restricted enhancer activity to predictable sets of neurons. We thank the reviewer for bringing this to our attention, because this was not intended. In response, we have restructured the Introduction and Discussion to more precisely state our view. This is most explicitly stated in a section starting with the following statement “We propose that the BMP-LA does not singularly specify Tv4 neuron activity, but rather imposes a requirement for pMad/Medea cooperative interactions with co-regulators or subtype-specific transcription factors bound to adjacent motifs for combinatorial activation of FMRFa expression.” This is followed by extensive discussion to explain our rationale for this conclusion and how the BMP-LA generates subtype-specific neuronal expression, based on evidence from this study and precedent from previous work. We also added a related edit in the Results section. We feel that this new discussion has improved our manuscript and clarifies our conclusions, while better addressing a model for how the BMP-LA motif functions in enhancers active across many cell types in neurons and across fly tissues.
The question that remains is if regions with perfect motives would do better or worse in restricting expression to these neurons.
We have incorporated a more thorough discussion of how we believe the BMP-LA motif generates cell-specific expression (as stated above). Our previous publication on the specification of gene expression within Tv4 neurons (1) identified two essential, non-redundantly acting, cis-elements that encode Tv4-neuron specification, an Apterous-responsive element (that we termed the HD-RE) and the BMPRCE element containing the BMP-LA identified herein. This is outlined at the start of the Results section. This HD-RE contains a “perfect” Apterous-binding motif, but Apterous is not sufficient alone for its expression, leading us to assume that other unidentified transcription factors are required to act at this cis-element. As these remain unidentified it is not possible to say whether their motif within the HD-RE is perfect or not. Regardless, while both ciselements encode Tv4-neuron specificity (which is only observed when we concatemerized each cis-element), the HD-RE is oblivious to BMP signaling; thus, the BMP-dependent activation of the FMRFa gene is entirely encoded within the BMP-RCE, via the BMP-LA. The combined activation of both motifs is required for FMRFa expression. Importantly, when we swap the BMP-LA for a high affinity BMP-AE motif, we do so in the context of the full-length Tv4 enhancer for the FMRFa gene (containing this HD-RE cis-element). Therefore, the more widespread ectopic expression of this reporter in motor neurons and its exclusion from the Tv4 neurons is driven by the more promiscuous BMP-AE motif, and no other cis-element with the Tv4 enhancer seems able to compensate or correct. Therefore, we feel confident in concluding that the BMP-LA plays essential roles in both conferring a BMP requirement for FMRFa expression, and also conferring Tv4 neuron specification to the full-length enhancer. We have added this discussion in paragraph four of the Discussion.
For other signalling systems similar low affinity motives provide instructive values in target gene regulation a phenomenon described as activation insufficiency and important for a signalling system not to dominate the regulation of the particular gene (for review see Barolo and Posakony, 2002). This raises the question if evolution placed this motive strength there to fit a certain signalling level. A question that could simply be addressed by increasing (dominant active, ligand overexpression) or decreasing (heterozygote ligand mutants, ts mutants) signaling activity and observe the reporter. In the current format the signalling twist is there but only for the FMRFamide gene and without any predictive input.
These are important points that we have expanded upon in our discussion. We would certainly agree that most natural BMP-RE instances exhibit activation insufficiency, regardless of whether they are low affinity or not. Our previous publication (1) offered a detailed study of the requirement for the numerous transcription factors that were combinatorically required for Tv4 enhancer of the FMRFa gene. However, in this manuscript we are attempting to show that the function of BMP responsive DNA motifs in an enhancer is not only to add a generic ability to respond to BMP signalling in any BMP-activated neuron subtype (regardless of its affinity), but that the low affinity of this BMP-RE was required to participate instructively in determining the subset of BMP-activated neurons an enhancer is active, in combination with other local transcription factors.
In previous publications, we tested the impact of heterozygosity for BMP pathway components and also overexpression of the pertinent signaling ligand Gbb, and also activated type I BMP-receptors, on expression of the FMRFa gene and also on reporters containing the BMP-LA (1–4). In all cases, no ectopic expression of the gene or the reporter was observed by BMP hyperactivation, unless we also co-misexpressed other transcription factors. Therefore, we conclude that responsiveness to a specific signal strength is not a major pressure that led to the specific sequence of the BMP-LA. These points have now been added to the Discussion section starting in paragraph three.
It is argued that “this manuscript defines how common intercellular signals so exquisitely direct subtype-specific gene expression profiles”. There are low affinity instructive models also for neurons. For example, in Drosophila the olfactory system the interaction between several low affinity motifs and chromatin has been modelled and tested to be required to restrict odorant receptor expression to a single neuron class. (Jafari and Alenius, 2015, González and Jafari et al., 2018). However, these factors are not related to known signaling systems one can argue and like that these findings become an advance. Nevertheless, the authors need to make the discussion more comprehensive to make that claim and define the mechanism in more detail.
We thank the reviewer for this valuable suggestion, and agree that adding this discussion strengthens the paper. The Introduction and Discussion have been substantially restructured and rewritten to provide a more comprehensive contemplation of these points. These highly relevant studies have been included in the Discussion.
Canadian Institutes of Health Research (MOP-98011)
Douglas W Allan
Canadian Institutes of Health Research (MOP-130517)
Douglas W Allan
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
The authors gratefully acknowledge Drs. Stefan Thor (Linkoping University, Sweden), Markus Affolter (University of Basel, Switzerland), Giorgos Pyrowolakis (University of Freiburg, Germany), Robin Vuilleumier, Hugh Brock, T Michael Underhill, Jacob Hodgson, Timothy O'Connor (University of British Columbia, Canada), and the Allan laboratory for their valuable assistance and comments. The authors gratefully acknowledge Drs. Konrad Basler and Johannes Bischof (University of Zurich, Switzerland), Jonathan Benito-Sipos (Universidad Autónoma de Madrid, Spain), Allen Laughon (University of Wisconsin - Madison, USA), Stefan Thor (Linkoping University, Sweden), Esther Verheyen (Simon Fraser University. Canada), and the Bloomington Drosophila Stock Centre (Indiana, USA) for genetic, molecular, or immunological reagents.
Senior Editor
K VijayRaghavan, National Centre for Biological Sciences, Tata Institute of Fundamental Research, India
Reviewing Editor
Oliver Hobert, Howard Hughes Medical Institute, Columbia University, United States
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
338
Page views
54
Downloads
0
Citations
Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Visual systems can exploit spatial correlations in the visual scene by using retinotopy. However, retinotopy is often lost, such as when visual pathways are integrated with other sensory modalities. How is spatial information processed outside of strictly visual brain areas? Here, we focused on visual looming responsive LC6 cells in Drosophila, a population whose dendrites collectively cover the visual field, but whose axons form a single glomerulus-a structure without obvious retinotopic organization-in the central brain. We identified multiple cell types downstream of LC6 in the glomerulus and found that they more strongly respond to looming in different portions of the visual field, unexpectedly preserving spatial information. Through EM reconstruction of all LC6 synaptic inputs to the glomerulus, we found that LC6 and downstream cell types form circuits within the glomerulus that enable spatial readout of visual features and contralateral suppression-mechanisms that transform visual information for behavioral control.
Previous studies have explored neurofeedback training for Parkinsonian patients to suppress beta oscillations in the subthalamic nucleus (STN). However, its impacts on movements and Parkinsonian tremor are unclear. We developed a neurofeedback paradigm targeting STN beta bursts and investigated whether neurofeedback training could improve motor initiation in Parkinson's disease compared to passive observation. Our task additionally allowed us to test which endogenous changes in oscillatory STN activities are associated with trial-to-trial motor performance. Neurofeedback training reduced beta synchrony and increased gamma activity within the STN, and reduced beta band coupling between the STN and motor cortex. These changes were accompanied by reduced reaction times in subsequently cued movements. However, in Parkinsonian patients with pre-existing symptoms of tremor, successful volitional beta suppression was associated with an amplification of tremor which correlated with theta band activity in STN LFPs, suggesting an additional cross-frequency interaction between STN beta and theta activities.
The mesiotemporal lobe (MTL) is implicated in many cognitive processes, is compromised in numerous brain disorders, and exhibits a gradual cytoarchitectural transition from six-layered parahippocampal isocortex to three-layered hippocampal allocortex. Leveraging an ultra-high-resolution histological reconstruction of a human brain, our study showed that the dominant axis of MTL cytoarchitectural differentiation follows the iso-to-allocortical transition and depth-specific variations in neuronal density. Projecting the histology-derived MTL model to in-vivo functional MRI, we furthermore determined how its cytoarchitecture underpins its intrinsic effective connectivity and association to large-scale networks. Here, the cytoarchitectural gradient was found to underpin intrinsic effective connectivity of the MTL, but patterns differed along the anterior-posterior axis. Moreover, while the iso-to-allocortical gradient parametrically represented the multiple-demand relative to task-negative networks, anterior-posterior gradients represented transmodal versus unimodal networks. Our findings establish that the combination of micro- and macrostructural features allow the MTL to represent dominant motifs of whole-brain functional organisation.